Political Forums  

Go Back   Defending The Truth Political Forum > Philosophy and Religion > Religion > Atheism

Thanks Tree359Thanks
LinkBack Thread Tools Display Modes
Old September 8th, 2015, 01:14 PM   #1081
Senior Member
RNG's Avatar
Join Date: Apr 2013
Location: Between everywhere
Posts: 29,135
Originally Posted by dadmansabode View Post
CODE IS DEFINED .. as communication between an encoder .. goober refute this if you like ..
or to make this simple .. just say yes .. I agree .. how bout a simple true or false question for goober ..
Is DNA considered to be code ...... yes or no
It is communication, but between itself and the next molecule to be made.

A more accurate analogy would be template.
RNG is offline  
Old September 8th, 2015, 02:45 PM   #1082
Senior Member
Join Date: Jul 2014
Location: massachusetts
Posts: 10,703
Originally Posted by dadmansabode View Post
............... indeed it is

noun, plural processes
[pros-es-iz, ‐uh-siz, ‐uh-seez or, esp. British, proh-ses-iz, proh-suh-seez]

1. a systematic series of actions directed to some end: to devise a process for homogenizing milk.
2. a continuous action, operation, or series of changes taking place in a definite manner: the process of decay.
3. Law ... the summons, mandate, or writ by which a defendant or thing is brought before court for litigation .. the whole course of the proceedings in an action at law.
4. Photography. photomechanical or photoengraving methods collectively
5. Biology, Anatomy. a natural outgrowth, projection, or appendage: a process of a bone.
6. the action of going forward or on.

7. the condition of being carried on .. verb (used with object)
10. to treat or prepare by some particular series of actions, as in manufacturing.
11. to handle (papers, records, etc.) by systematically organizing them, recording or making notations on them, following up with appropriate action, or the like: to process mail.
12. to require (someone) to answer questionnaires, perform various tasks, and sometimes to undergo physical and aptitude
classification examinations before the beginning or termination of a period of service: The army processes all personnel entering or leaving the service.
13. to convert (an agricultural commodity) into marketable form by a special series of steps, as pasteurization.
14. to institute a legal process against; prosecute.
15. to serve a process or summons on.
16. Computers. to carry out operations on (data or programs).

CODE IS DEFINED .. as communication between an encoder .. goober refute this if you like ..
or to make this simple .. just say yes .. I agree .. how bout a simple true or false question for goober ..
Is DNA considered to be code ...... yes or no
Yes DNA contains encoded information, information used by the process of life to build proteins.

We already can show that the conditions believed to exist created amino acids, the building blocks of proteins, that all the material for the process of life to begin was present, all that was needed was for this material to be formed into a self replicating process.

A highly unlikely event, but not impossible.
And much more likely than the existence of an all powerful supernatural intelligence.
Thanks from RNG and Sabcat
goober is offline  
Old September 8th, 2015, 03:55 PM   #1083
Senior Member
Nwolfe35's Avatar
Join Date: Jul 2008
Location: Virginia Beach, VA
Posts: 15,815
Originally Posted by dadmansabode View Post
how bout this one ... is morse code more complex than genetic code in DNA

welp !! gotta go for now ... catch yall later
Yes, Morse Code IS more complex than DNA

Morse Code uses (in English) codes for 26 letters and 10 digits (0-9) for a total of 36 codes.

DNA only has four, cytosine (C), guanine (G), adenine (A), or thymine (T). Furthermore the combinations of these four codes is very limited, A-G and C-T.

What makes DNA so "complex" are two factors.

1. The sheer number of base pairs in a molecule of DNA (approx. 220 MILLION)

2. We don't fully know what they mean.

Imagine the entire Bible encoded into Morse Code. There are about 3 million letters in the King James version of the Bible. 26 different letters. And then you hand that coded book with no other instructions, to someone and ask them to decode it.

So while there are only 4 "letters" in the code of DNA there are 220 million of them in a DNA molecule AND it isn't "written" in a language we understand (hand that encoded Bible to someone who doesn't speak English)

What you have to understand is how long it took to get that code to where it is in human DNA. About 4 billion years from the time the first "life" formed on earth to the time the first members of the species Homo appeared (approx. 2 million years ago) and then another 2 million years of evolution to produce modern man.

Think about this. 2 MILLION years from the first human like ancestors to today. Recorded human history is only about 5,000 years old...and that only makes up about .04% of the 2 million years and the 2 million years only makes up about .5% of the time for life to evolved.

Most people cannot wrap their minds around the absolutely HUGE scale of time we are talking about.

So the idea that this (what we consider) incredibly complex "code" to have developed is not so outlandish and is FAR less outlandish then the idea that some infinitely far more complex creature (who, despite his complexity, didn't apparently need a creator of his own) created us.
Nwolfe35 is offline  
Old September 9th, 2015, 06:09 AM   #1084
Jesus is the truth
dadmansabode's Avatar
Join Date: Sep 2015
Location: USA
Posts: 201
Originally Posted by goober View Post
Yes DNA contains encoded information, information used by the process of life to build proteins
Indeed DNA: the tiny code thats toppling evolution

DNA contains a genetic language

Let's first consider some of the characteristics of this genetic 'language.' For it to be rightly called a language, it must contain the following elements:
an alphabet or coding system, correct spelling, grammar (a proper arrangement of the words), meaning (semantics) and an intended purpose.

Scientists have found the genetic code has all of these key elements. “The coding regions of DNA,” explains Dr. Stephen Meyer, “have exactly the same relevant properties as a computer code or language” (quoted by Strobel, p. 237, emphasis in original).

The only other codes found to be true languages are all of human origin. Although we do find that dogs bark when they perceive danger, bees dance to point other bees to a source and whales emit sounds, to name a few examples of other species' communication, none of these have the composition of a language. They are only considered low-level communication signals.

The only types of communication considered high-level are human languages, artificial languages such as computer and Morse codes and the genetic code.
No other communication system has been found to contain the basic characteristics of a language.

Bill Gates, founder of Microsoft, commented that “DNA is like a software program, only much more complex than anything we've ever devised.”

Can you imagine something more intricate than the most complex program running on a supercomputer being devised by accident
through evolution—no matter how much time, how many mutations and how much natural selection are taken into account? .....
continue >

goober = "all that was needed was for this material to be formed into a self replicating process" << lol ya killn me

sorry guys ... but supressing truth is not good for you ... Romans 1

01:18 .. for the wrath of God is revealed from heaven against all ungodliness and unrighteousness of men who suppress the truth in unrighteousness
01:19 .. because that which is known about God is evident within them .. for God made it evident to them
01:20 .. for since the creation of the world his invisible attributes .. his eternal power and divine nature .. have been clearly seen ..
.......... being understood through what has been made .. so that they are without excuse

Last edited by dadmansabode; September 9th, 2015 at 09:43 AM.
dadmansabode is offline  
Old September 9th, 2015, 09:40 AM   #1085
Jesus is the truth
dadmansabode's Avatar
Join Date: Sep 2015
Location: USA
Posts: 201
Originally Posted by Nwolfe35 View Post
Yes, Morse Code IS more complex than DNA
I think I'll take the words of Bill Gates (founder of Microsoft) over Nwolfe35 ... sorry wolfie
dadmansabode is offline  
Old September 9th, 2015, 10:06 AM   #1086
Senior Member
Nwolfe35's Avatar
Join Date: Jul 2008
Location: Virginia Beach, VA
Posts: 15,815
Originally Posted by dadmansabode View Post
I think I'll take the words of Bill Gates (founder of Microsoft) over Nwolfe35 ... sorry wolfie
Except (according to your own post) Bill Gates said that DNA was more complex than any software program ever devised. Learn the difference between program and code.
Thanks from RNG
Nwolfe35 is offline  
Old September 9th, 2015, 10:08 AM   #1087
Senior Member
LongWinded's Avatar
Join Date: Jun 2014
Location: United States
Posts: 11,828
Originally Posted by dadmansabode View Post
Indeed DNA: the tiny code thats toppling evolution

DNA contains a genetic language

Let's first consider some of the characteristics of this genetic 'language.' For it to be rightly called a language, it must contain the following elements:
an alphabet or coding system, correct spelling, grammar (a proper arrangement of the words), meaning (semantics) and an intended purpose.

Scientists have found the genetic code has all of these key elements. “The coding regions of DNA,” explains Dr. Stephen Meyer, “have exactly the same relevant properties as a computer code or language” (quoted by Strobel, p. 237, emphasis in original).

The only other codes found to be true languages are all of human origin. Although we do find that dogs bark when they perceive danger, bees dance to point other bees to a source and whales emit sounds, to name a few examples of other species' communication, none of these have the composition of a language. They are only considered low-level communication signals.

The only types of communication considered high-level are human languages, artificial languages such as computer and Morse codes and the genetic code.
No other communication system has been found to contain the basic characteristics of a language.

Bill Gates, founder of Microsoft, commented that “DNA is like a software program, only much more complex than anything we've ever devised.”

Can you imagine something more intricate than the most complex program running on a supercomputer being devised by accident
through evolution—no matter how much time, how many mutations and how much natural selection are taken into account? .....
continue >

goober = "all that was needed was for this material to be formed into a self replicating process" << lol ya killn me

sorry guys ... but supressing truth is not good for you ... Romans 1

01:18 .. for the wrath of God is revealed from heaven against all ungodliness and unrighteousness of men who suppress the truth in unrighteousness
01:19 .. because that which is known about God is evident within them .. for God made it evident to them
01:20 .. for since the creation of the world his invisible attributes .. his eternal power and divine nature .. have been clearly seen ..
.......... being understood through what has been made .. so that they are without excuse

When you are quoting from a radical religious right blogger, you should give reference to it. THIS is science being presented and this isn't YOUR words.

You are deceitful and only capable of logical fallacies because you don't have a leg to stand on.

DNA: The Tiny Code That's Toppling Evolution | United Church of God
LongWinded is offline  
Old September 9th, 2015, 10:10 AM   #1088
Senior Member
LongWinded's Avatar
Join Date: Jun 2014
Location: United States
Posts: 11,828
Originally Posted by dadmansabode View Post
I think I'll take the words of Bill Gates (founder of Microsoft) over Nwolfe35 ... sorry wolfie
You have your own forum? What a hoot. You spread these lies all over the place. You spread this information which is NOT yours. You plagarize all this stuff. What a cad and anti-intellect,.
Thanks from Sabcat
LongWinded is offline  
Old September 9th, 2015, 10:15 AM   #1089
Jesus is the truth
dadmansabode's Avatar
Join Date: Sep 2015
Location: USA
Posts: 201
Originally Posted by LongWinded View Post
You plagarize all this stuff
what !! you not click the link I provided ??

DNA: the tiny code thats toppling evolution .. continue >

Last edited by dadmansabode; September 9th, 2015 at 10:31 AM.
dadmansabode is offline  
Old September 9th, 2015, 10:19 AM   #1090
Jesus is the truth
dadmansabode's Avatar
Join Date: Sep 2015
Location: USA
Posts: 201
Originally Posted by Nwolfe35 View Post
Learn the difference between program and code.
um .. computer program IS code ... so is DNA

<link rel="stylesheet" type="text/css" href="http://defendingthetruth.com/clientscript/vbulletin_important.css?v=387" /> <script type="text/javascript" src="http://yui.yahooapis.com/2.9.0/build/yahoo-dom-event/yahoo-dom-event.js?v=387"></script> <script type="text/javascript" src="http://yui.yahooapis.com/2.9.0/build/connection/connection-min.js?v=387"></script> <script type="text/javascript"> <!--
var SESSIONURL = "";
var SECURITYTOKEN = "1441822760-491bc7e5e94d1208d924040d04c4441d92ed7104";
var IMGDIR_MISC = "http://cdn.defendingthetruth.com/images/dtt/misc";
var vb_disable_ajax = parseInt("0", 10);
// --> </script> <script type="text/javascript" src="http://defendingthetruth.com/clientscript/vbulletin_global.js?v=387"></script> <script type="text/javascript" src="http://defendingthetruth.com/clientscript/vbulletin_menu.js?v=387"></script> <link rel="alternate" type="application/rss+xml" title="Defending The Truth Political Forum RSS Feed" href="http://defendingthetruth.com/external.php?type=RSS2" /> <link rel="alternate" type="application/rss+xml" title="Defending The Truth Political Forum - Atheism - RSS Feed" href="http://defendingthetruth.com/external.php?type=RSS2&amp;forumids=44" /> <link href="http://defendingthetruth.com/android-app://com.quoord.tapatalkpro.activity/tapatalk/defendingthetruth.com%3Fuser_id%3D7049%26location% 3Dtopic%26fid%3D44%26tid%3D21387" rel="alternate" /> <style type="text/css" id="vbulletin_editor_css_dynamic"> <!--
@import url("clientscript/vbulletin_editor.css?v=387");

.vBulletin_editor {
background: #E1E1E2;
padding: 6px;
.imagebutton {
background: #E1E1E2;
color: #000000;
padding: 1px;
border: none;
.ocolor, .ofont, .osize, .osmilie, .osyscoloar, .smilietitle {
background: #FFFFFF;
color: #000000;
border: 1px solid #FFFFFF;
.popup_pickbutton {
border: 1px solid #FFFFFF;
.popup_feedback {
background: #FFFFFF;
color: #000000;
border-right: 1px solid #FFFFFF;
.popupwindow {
background: #FFFFFF;
#fontOut, #sizeOut, .popup_feedback div {
background: #FFFFFF;
color: #000000;
.alt_pickbutton {
border-left: 1px solid #E1E1E2;
.popup_feedback input, .popup_feedback div
border: 0px solid;
padding: 0px 2px 0px 2px;
cursor: default;
font: 11px tahoma;
overflow: hidden;
--> </style>

100100101101011011010101 same as tagcacgtacgtcgactcgtacgtgactgtagctc ......

Last edited by dadmansabode; September 9th, 2015 at 10:24 AM.
dadmansabode is offline  

  Defending The Truth Political Forum > Philosophy and Religion > Religion > Atheism

atheism, day

Thread Tools
Display Modes

Similar Threads
Thread Thread Starter Forum Replies Last Post
An Interesting Quote Josiah Political Talk 38 January 26th, 2014 03:45 AM
Spiritual Quote of the Day imaginethat Other Religions 45 December 24th, 2013 05:41 PM
A Quote From Two Smart Men Danjb25 U.S. Federal Policy 1 February 7th, 2012 07:37 AM
Scientific Quote of the Day baloney_detector Science and Technology 13 September 8th, 2007 05:44 AM

Facebook Twitter RSS Feed

Copyright © 2005-2013 Defending The Truth. All rights reserved.